Een nieuw artikel
Genen en gezinnen
1 ondersteunende bron
vertrouwen 97%
nieuwheid 75%
Identification and functional analysis of a novel SMARCC2 splicing variant in a family with syndromic neurodevelopmental disorder
Background To determine the pathogenicity of a novel splicing variant in the SMARCC2 gene identified from a pair of adult male monozygotic twins with neurodevelopmental disorder, and to investigate the genotype-phenotype characteristics associated with SMARCC2 variants.
Hoe dit tot stand kwam
Geïndexeerd uit **pmc** op 2026-11-13 (relevantie 1.00, niveau peer-reviewed).
Gegenereerd 2026-11-13, laatst gewijzigd
gisteren. Dedup-sleutel newdoc:381.
De engine controleert dit inzicht bij elke analyse opnieuw; als meer bronnen het eens zijn, stijgen zijn onderbouwing en vertrouwen en verschijnt het opnieuw als “nieuw”.
Bewijs (1 citaat)
Identification and functional analysis of a novel SMARCC2 splicing variant in a family with syndromic neurodevelopmental disorder
peer-reviewed
· gepubliceerd 2025-01-01
· live pagina
TA-clone sequencing showed that 75% of the clones were 654-bp products, and the other 25% were novel transcripts with an extra 93 bp from intron 18 (ggccgccaggttgatgctgataccaaggctgggcgaaagggcaaagagctggatgacctggtgccagagacggctaagggcaagccagagctg).
Ondersteunende documenten (1)
| Verhaal | Bron | Gepubliceerd | Gezien | Relevantie |
|---|---|---|---|---|
| Identification and functional analysis of a novel SMARCC2 splicing ... | pmc | 2025-01-01 | gisteren | 1.00 |