17q12, explained for kidsdeletion syndrome · static snapshot
Adults Scientists Kids EN NL
Everything here was found on the internet and put together with help from a computer program that reads and writes (AI). It is here so you can learn — it is not the final word. Always check the real source. Read the whole notice
A new article Genes and families 1 supporting source confidence 97% novelty 75%

Identification and functional analysis of a novel SMARCC2 splicing variant in a family with syndromic neurodevelopmental disorder

Background To determine the pathogenicity of a novel splicing variant in the SMARCC2 gene identified from a pair of adult male monozygotic twins with neurodevelopmental disorder, and to investigate the genotype-phenotype characteristics associated with SMARCC2 variants.

More a new article

How this was derived

Indexed from **pmc** on 2026-11-13 (relevance 1.00, tier peer_reviewed).

Generated 2026-11-13, last changed yesterday. Dedup key newdoc:381. The engine re-checks this insight on every analysis run; if more sources agree, its corroboration and confidence go up and it reappears as “new”.

Evidence (1 quote)

Identification and functional analysis of a novel SMARCC2 splicing variant in a family with syndromic neurodevelopmental disorder peer_reviewed · published 2025-01-01 · live page
TA-clone sequencing showed that 75% of the clones were 654-bp products, and the other 25% were novel transcripts with an extra 93 bp from intron 18 (ggccgccaggttgatgctgataccaaggctgggcgaaagggcaaagagctggatgacctggtgccagagacggctaagggcaagccagagctg).

Supporting documents (1)

StorySourcePublishedSeenRelevance
Identification and functional analysis of a novel SMARCC2 splicing ... pmc 2025-01-01 yesterday 1.00