New publication
Genes & inheritance
1 supporting source
confidence 97%
novelty 75%
Identification and functional analysis of a novel SMARCC2 splicing variant in a family with syndromic neurodevelopmental disorder
Background To determine the pathogenicity of a novel splicing variant in the SMARCC2 gene identified from a pair of adult male monozygotic twins with neurodevelopmental disorder, and to investigate the genotype-phenotype characteristics associated with SMARCC2 variants.
How this was derived
Indexed from **pmc** on 2026-11-13 (relevance 1.00, tier peer_reviewed).
Generated 2026-11-13, last changed
yesterday. Dedup key newdoc:381.
The engine re-checks this insight on every analysis run; if more sources agree, its corroboration and confidence go up and it reappears as “new”.
Evidence (1 quote)
Identification and functional analysis of a novel SMARCC2 splicing variant in a family with syndromic neurodevelopmental disorder
peer_reviewed
· published 2025-01-01
· live page
TA-clone sequencing showed that 75% of the clones were 654-bp products, and the other 25% were novel transcripts with an extra 93 bp from intron 18 (ggccgccaggttgatgctgataccaaggctgggcgaaagggcaaagagctggatgacctggtgccagagacggctaagggcaagccagagctg).
Supporting documents (1)
| Document | Source | Published | Seen | Relevance |
|---|---|---|---|---|
| Identification and functional analysis of a novel SMARCC2 splicing ... | pmc | 2025-01-01 | yesterday | 1.00 |